Thursday, December 13, 2012

Rays from Our DNA Structure





Every living thing is composed of a collection of cells that move according to their duties. The human body, for example, is composed of more than 10 trillion cells which originally came from the results of a cell's division. Inside each cell there is a cell nucleus (nucleus) in which several chromosomes (23 pairs) are located. The chromosome itself is a collection of proteins and deoxyribonucleic acid (DNA).


DNA carries all the genetic information about our body which will later be passed on to the next generation. If we imagine DNA as a book, which contains various written information from 23 chapters (chromosomes) where on each chromosome there are thousands of story information (genes). Unlike us who write information with 26 alphabet letters, in this DNA book each word is written using only 4 letters, namely A, C, T, and G.


Examples of writing are as follows: ATGCTGATCGATGCAGAATCGATC ...

The length of information in the DNA is around 3,000,000,000 letters which if we read it every day for 8 hours / day, it would take 100 years to complete it.

In each cell there are more than 20,000 genes (which are part of DNA) that we know today that have their respective tasks in our bodies. Genes basically produce proteins that are used to build our bodies. Each gene is responsible for producing different proteins (each gene produces around 10 different proteins). The gene through which the protein is produced will determine how our characteristics (both structural, biochemical, physiological, and behavioral) are known as phenotypes. The point is the genes that make us blue-eyed, blond or tall-bodied.


Gene also regulates how we process food efficiently, detoxify poisons and so on.


Although each gene has its own function, they work, collaborate in groups or networks (called genetic pathways), both small networks and very large networks to carry out their specific functions (metabolism). They interact and need each other. These networks are very complicated which until now researchers have tried to understand and simplify them.


If a gene is damaged or changes / mutates then the entire network where the gene is located will also be affected.


A very large, very complex system that is happening at this time in us. Looking at all the complexity of the system there are a number of things that we can ponder and learn from:


one.
The greatness of Allah SWT to us.
We don't need to regulate (let alone make) all these things, God has given us "free".
Fabiayyi ala i rabbikuma tukadziban? "Then which of the favors of your Lord will ye deny? A verse which is repeated by Allah till about 30x.
"When you count the favors of Allah (which is given to you) then you will not be able (for too many)." An-Nahl: 18.

Seeing the magnitude of God's favor is very worthy if we give thanks as the word of God: "We have created a man from a drop of mixed semen. We want to test it with the burden of commandments and prohibitions. Therefore we made him listen and see. the straight: Some are grateful, but some are unbelievers. (Al-Insan: 2-3)


two.
Ukhuwah Islamiyah.
We should work like genes in a large network to achieve the same goals / goals. Every one of us, Muslim / Muslim, has their own duties but in a network that each of us is a player with a task given to us, not fighting over each other's tasks or even throwing assignments. Like the soccer team, there are those who are in charge of guarding the goal, there are those who score. Playing ball is not just for scoring but also how we don't concede goals, all players have an equal role ...

Isn't "the parable of a believer with another believer in tenderness and affection, like one body. If there is a part of the body that feels pain, then all other parts of the body feel it" (Narrated by Imam Muslim).


3.
Proof of the greatness of God and the Creator of God
All the complexities in our body system are proof of the greatness of Allah SWT as in His words:
"We will show them our signs in all regions of the earth and themselves, until they are clear
that the Qur'an is true. Is it not enough that thy Lord is witness over all things?

From the complex processes that occur within our bodies, we and most researchers will certainly wonder, who does it, teaches each gene to do its own function. Who regulates, coordinates the network, (who is the keeper, who is the midfielder) and who is the one who created them?


For us Muslims, of course, know the answer to all these basic questions, namely GOD Almighty. But most of the researchers who witnessed the greatness of God every day were not moved towards God.


Alhamdulillah for us who have been given guidance into our hearts because not everyone will be given guidance except by His permission: "Indeed you will not be able to guide your loved ones, but Allah guides the person whom He wills, and God is more know those who want to receive guidance. " (QS Al Qashash: 56).


There are many more lessons learned from both our DNA system and the surrounding environment. We can know God not only by studying the verses of Qauliyah, but also by paying attention to the environment, which is kauniah verses. God knows how to answer.


Uncle

Stockholm Sweden
[email protected]


EM / TheTrutSeekerMedia

4,000 KM Palapa Ring Optical Fiber Built in 2013






Jakarta - Telkom will resume its delayed infrastructure development in the second phase of the Palapa Ring program which is estimated to spend Rp 2.4 trillion for the construction of 4,000 kilo meters of fiber optics.

The Palapa Ring development for the Manado, Ternate, Halmahera, Ambon, Fak-fak, Timika, and Sorong routes will be held after Telkom gets the winner of the procurement of its fiber optic tender in the first half of 2013.

"We will hold the second phase of the Palapa Ring tender in Q1 or Q2 2013. This is to support the Indonesia Digital Network (IDN) program," said Telkom's Managing Director Arief Yahya who recently won the 2012 Best BUMN CEO award in Jakarta .

Telkom will launch the IDN program because currently the new optical fiber stretches 23,713 kilo meters or 69% nationally. "We hope that by 2015, national optical fiber can be stretched," Arief said.

In the IDN program ID-Access (High Speed ​​Optical Access Network), ID-Ring (IP and Optical Backbone Network), and ID-Con (Convergence Service Platform) will be developed.

At present Telkom's optical fiber capacity has the ability to serve four million customers. While new customers use two million.


It is expected that with the increase in the development of optical fiber, the capacity can increase to six to eight million while the customers served by four million users.


Furthermore, regarding the second phase of the Palapa Ring program, there are three global companies that have passed prequalification. The three companies are NEC, Fujitsu, and ASN.

The construction of optical fiber will continue the Mataram-Kupang route along 1,041 kilo meters which has been built in the first phase of the Palapa Ring program and costs around Rp 600 billion.

Previously, the second phase of the PalapaRing tender was planned for completion in July 2012. However, because it is not yet clear the vendor financing scheme offered by auction participants, this auction has finally been delayed and new
Next year starts again.


D/TheTruthSeekerMedia

Immunity of the US Army





Afghan President Hamid Karzai is likely to provide legal immunity for US troops after 2014 provided the US wants to respect Afghan sovereignty.


At present, the US is preparing to withdraw around 60,000 troops from Afghanistan. The troop withdrawal is planned to be completed by the end of 2014, but the US plans to continue to leave some of its troops in Afghanistan for training missions.


Karzai said, "I am willing to give legal immunity to US troops residing in Afghanistan, as long as the US will respect the sovereignty, the law, and the people of Afghanistan and help train our security forces."


However, Karzai stressed that the new Kabul government would provide legal immunity to US troops in Afghanistan after they were sure they were actually carrying out these conditions.


Another requirement set by Karzai in return for immunity from US troops is the control of US military headquarters in the hands of the Afghan army and the cessation of attacks often carried out by US troops to villages in Afghanistan.


In addition, Karzai also requested US-owned prisons in Afghanistan to be closed and Afghan prisoners inside to be released.

The impunity of US forces settled in Afghanistan after 2014, was among the White House's objectives in negotiations with Kabul regarding the two countries' security agreement.

Negotiations between Kabul and Washington to reach an agreement and security cooperation have been started since last month. In the first round of negotiations, the Afghan Ambassador in the US, Eklil Hakimi and the Deputy US Special Envoy for Afghanistan and Pakistan Affairs, James B. Warlick, led the delegations of each country at the meeting.


The US, besides targeting legal immunity for its troops, also seeks permission to build permanent bases in Afghanistan. However, several ethnic, political and religious groups and a number of Afghan parliamentarians responded negatively to security negotiations with the United States.


They fear that impunity by US forces will increase the massacre of Afghan civilians. Foreign forces in Afghanistan in recent years - despite not having legal impunity - have created a humanitarian tragedy in the country and it is inconceivable what would happen to Afghan civilians if such privileges were truly granted to the United States.


Political observers believe that the Afghan government must take preventative measures with the aim of safeguarding the safety of civilians and their property. Of course this is by paying attention to the destructive actions of US and NATO forces while waging war in Afghanistan.


The Afghan people hope Karzai puts forward national interests in negotiating with the US and rejects all forms of pressure. Because, insecurity and instability continues to increase in Afghanistan, despite the presence of around 130,000 US-led forces in the country.


Not to mention, the long-term presence of US forces in Afghanistan is considered a serious threat to regional security and stability. Contemporary experience in countries, such as Germany and Japan, shows that the presence of foreign forces in any country will violate the country's sovereignty.


IRIB / TheTrutSeekerMedia

Poor People's Face in Saudi Arabia





Although the Saudi Arabian government is trying hard to hide the true numbers of unemployed and poor people in this country, various news sources report an increase in poor and unemployed people in Saudi Arabia.


The Washington Post newspaper in a report on Wednesday stated that millions of Saudi Arabians, even though they live in rich countries, live below the poverty line and government programs to create jobs and social security fail.


Saudi Arabia, one of the richest countries in the Arab World. This country after Russia was listed as the largest producer of world crude oil and every day produces more than 10 million barrels of oil. For the world's largest oil reserves, Saudi Arabia is second only to Venezuela. This means that one-fifth of the world's oil reserves are owned by Saudi Arabia at around 260 billion barrels.


Saudi Arabia exports 7.5 million barrels every day and 55 percent of oil demand in the Far East is supplied by Riyadh. Oil constitutes 80-90 percent of Saudi Arabia's government revenue and 40 percent of gross domestic product (GDP) is controlled by oil products.


Apart from oil, Saudi Arabia gets a large annual income from the Hajj ritual. Based on World Bank statistics, the government of Saudi Arabia gets annual income of more than 30 billion dollars from the Hajj ritual. Although Saudi Arabia has large revenues, news sources report high rates of poverty and unemployment in various regions of Saudi Arabia. The data shows that a quarter of Saudi Arabians live below the poverty line.


On the other hand, the Riyadh government said the unemployment rate in this country reached 10.5 percent, but observers and the media considered that the unemployment rate in Saudi Arabia exceeded 36 percent. While when unemployment in Saudi Arabia is increasing, foreign workers in this country are recorded at eight million and 90 percent work in the private sector. This is also driven by the lack of quality education in Saudi Arabia so that the private sector is more likely to attract foreign workers than the indigenous population.


The Government of Saudi Arabia is always trying to cover up the human resource index, including unemployment and poverty or at least minimizing it from the actual figure. This condition is also supported by the government's hard policies, because anyone who dares to write unemployment and poverty rates in this country correctly will be arrested by the security forces.


Poverty and unemployment in Saudi Arabia are increasingly crawling as the al-Saud family squanders state wealth for personal gain, intervenes in other country's internal affairs and buys weapons.

The serious threat facing the world due to inflation, low human resources, poverty and unemployment is now also threatening Saudi Arabia. One of the reasons for the widespread protests in the country in the past two years has also been related to the unfair distribution of state wealth, rising poverty, declining power of the people of Bali and increasing unemployment.

The people of Saudi Arabia are demanding the eradication of corrupt practices, especially in the midst of the al-Saud family, reducing the budget for purchasing weapons and intervention in other countries and the government's efforts to reduce poverty and unemployment.


IRIB / TheTrutSeekerMedia

Khaled Miys'al: Hamas Refuses Zionist-Israeli Existence





Gaza City - The head of the Hamas Political Bureau, Khaled Misy'al, asserted that Zionist-Israel has no right to Israel's life. Misy'al openly rejects Israel's existence. The entire territory now being the state of Israel, must return to the Palestinian people. Because, the state of Israel, is no other colonizer, who has robbed, and expelled the Palestinian population, and made it a state.

The Hamas leader, who has been in Gaza since Friday, visited Gaza, and dissolved in the commemoration of the 25th anniversary of Hamas, in Gaza City, and in front of hundreds of thousands of Hamas supporters and fighters, insisting that Hamas had never withdrawed claims over all Israel , and will never recognize the Zionist-Israeli state. Khaled Misy'al along with the Hamas movement, will continue to fight with all the capabilities and sacrifices that will be made to reclaim Palestinian land from the hands of the Zionist-Israel, he said on Saturday.


In the midst of the hundreds of thousands of supporters and Hamas cadres, Khaled Misy'al, said on the rights of the Palestinian people, to Palestinian lands, and never handed over a land of Palestinian land to Zionist-Israel. The Hamas leader asserted that it would not hand over a land to the Zionists, and the Palestinian land, stretching from the Mediterranean to the Jordan, from north to south. This is the ideals of Hamas and Palestinians who have never changed forever, until they all come true.


Misyal added that it was not legitimacy for occupation and occupation by the Zionist-Israeli regime. Forever occupation and occupation did not have the right of existence, and had to be resisted with all the struggles that had to be carried out in order to expel the Zionist-Israeli invaders, who now robbed and robbed the Palestinian legitimate rights. Since l948, it has given birth to a variety of incomparable human tragedies.


The Misy'al statement, in fact, represents the whole aspirations of the Palestinian people who are in the diaspora, and are in different parts of the world, due to the Zionist-Israeli settlements, and being driven by the Zionist-Israeli regime. Millions of Palestinians who were forced to leave their homeland by the Zionist-Israeli occupation, and they lived without citizenship. They are stacked all over the world, while their homeland has belonged to the Zionist-Israrel invaders.


Therefore, the Head of the Hamas Bureau, Khalid Mis'al, who left Gaza from childhood (age 11), invites all the political and armed forces of the Palestinian people to unite against the Zionist-Israel. Misyal has communicated with President Mahmoud Abbas, whose aim is to unite all existing forces including al-Fatah, which is led by President Mahmud Abbas, in Ramallah, the West Bank.


The steps pursued by Hamas, al-Fatah, and Egypt, whose aim is to unite all political and military forces in Palestine, to merge and unite into one force facing the Zionist-Israeli forces. With the unification of the power of the Palestinian people, it signifies the closer the ideals that want to be upheld, namely the establishment of a Palestinian state.


Now that there are thousands of mujahidin from various countries gathered in Gaza, they have been prepared with all the strength they have, and new weapons, and they expect a land war against the Zionist-Israel.


The strength of Hamas will not be easily defeated by Zionist-Israel, and that has been proven by the Zionist-Israeli military invasion, December 2008, and then Prime Olmert announced a ceasefire in January 2009, in the middle of the night. A few weeks ago, Zionist-Israel had placed hundreds of tanks along the border with Gaza, and mobilized 80,000 troops, but Zionists-Israel did not dare to carry out a ground war. As a result, Israeli Defense Minister Ehud Barak resigned.


Khaled Misy'al very firmly rejected the existence of Zionist-Israel, as a political entity, and the establishment of an Israeli state, which affected and colonized the Palestinian people. So, the statement of Khaled Misy'al, is a reaffirmation of the idealism of Palestinian leaders who strongly reject colonialism. Wallahu'alam.


VoaIslam/TheTruthSeekerMedia

Ignore Sampang Refugees, Government Ignores Constitution





Saturday, December 8, 2012 at 11.00-14.00 WIB, around 200 people rallied in front of the State Palace. They consist of several organizations including the Sampang Solidarity Alliance, LBH Universalia, the Red and White Holy Guard, Ahlul Bait Indonesia, Bela Keadilan, and the Bhinneka Tunggal Ika National Alliance (ANBTI).


The demonstration was held as a demand for the Republic of Indonesia State Government, which was considered to have ignored the mandate of the Constitution for ignoring the rights of Shia refugees in Sampang. They also demanded the release of the Shia community leader Sampang Ustad Tajul Muluk. Because, Tajul is a victim of the legal mafia and injustice. A public examination showed that the verdict on Tajul was full of violations of formal and material law.


In the speech, Ir Mujtahid Hashem as the representative of the Red and White Sacred Guards, Ustad Hasan Dalil Alaydrus (Chairperson of the ABI), and Ustad Akhmad Hidayat (Secretary General of the ABI) expressed an open demand to the President of the Republic of Indonesia to immediately restore Sampang refugee rights and free Ustad Tajul . Several speeches from other representatives also shouted the same demands.


The protest took place peacefully without any riots. This is proof of love for the nation. The demonstration began with singing the National Anthem "Indonesia Raya".

At the end of the event, several representatives from the demonstrators were given the opportunity to meet the President's Military Secretary to hand over a community support postcard for the release of Ustad Tajul Muluk. They also conveyed the following demands.


1. Demanding the Sampang Regency Government, the East Java Provincial Government, and the Government of the Republic of Indonesia to immediately seek the return of returning Shia refugees to their hometown.
2. Demanding that the Republic of Indonesia Police provide security and safety for the Shia Sampang refugees when they return to their hometowns.
3. Demand the Government of Sampang Regency, the Government of East Java Province, and the Government of the Republic of Indonesia to restore the rights of Shia Sampang residents which include reconstruction, rehabilitation and compensation.
4. Appealing to the Supreme Court to grant the cassation of cleric Tajul Muluk and release him from the indictment because he was involved in a crime based on his beliefs and religion (prisoner of conscience) Moreover, public examinations of the verdicts of the Sampang District Court show the judges' violations of formal and material law.

News Protest / TheTrutSeekerMedia

Turkish People Hold Demonstrations on Patriot Missile Placement Protests





The Turkish people held a demonstration against the placement of Patriot missiles in their country.

The Turkish government policy that places a number of Patriot missiles in the country's border region with Syria, has drawn strong protests from thousands of residents. ISNA reported (10/12) quoting Al Manar TV.

Several leaders of Turkey's opposition parties in the demonstration stressed that the government politics of Recep Tayyip Erdogan, the Prime Minister of Turkey would drag the country into war.


Meanwhile, the Turkish government claimed that the placement of the Patriot was intended to protect its citizens from the potential danger of Syrian missiles, even though the majority of the country's people held an action protesting the government's move.


According to the Turkish newspaper Todays Zaman, at least 600 foreign troops and six Patriot missiles will be stationed in the border regions of Turkey and Syria.


Land-to-air missiles capable of disabling ballistic missiles, within four to five weeks will be transferred to Turkey by sea.

Germany, the United States and the Netherlands are NATO member countries which have the most recent types of Patriot missiles. These three countries agreed to each send two Patriot missiles to Turkey.

Germany and the Netherlands announced that they would send two Patriots equipped with multi-function launchers to Turkey. The two countries' parliament plans to ratify the policy of placing Patriot missiles in Turkey taken by the government.


Six NATO missile launchers were able to load 16 Patriot missiles, and each system needed 100 soldiers to operate it. Therefore, Germany, the US and the Netherlands must at least send 600 troops to Turkey.

The cost of transporting the defense system is borne by the sending country, and Turkey itself must bear the costs of soldiers stationed in its territory.
The Dutch government announced that the missiles should not be used for hostile actions.

Mark Rutte, Prime Minister of the Netherlands at his weekly press conference said, "The main purpose of the placement of the missile defense system is not to create a no-fly zone or invasion."

Dutch Defense Minister Jeanine Hennis said, "These missiles will arrive in Turkey in mid-June 2013."


IRIB / TheTrutSeekerMedia

This is a Contact Lens that is able to project incoming images and messages

Researchers from Ghent University in Belgium are developing a technology that allows incoming messages from cellphones to be seen directly withcontact lens used. Contact lens made of this concave LCD can be used as a contact lens normal, while projecting writing and images from handphone with Wi-Fi as its main link.






Previously, this technology was only a concept that could not be applied as a concept
contact lens.The ability to fully project images cannot be realized.

The Microsystem Technology Division at Ghent University has succeeded in realizing the basic concepts of this technology. According to Professor Herbert De, which we adapted from Telegraph.co.uk, the team has succeeded and will continue to develop it until it reaches a perfect point.


Most likely, part of the concept that will be developed further relates to the level of comfort of its use in the same eye as contact lens conventional.Contact lens this might also be developed so that it can function as an "eyeglass" that is able to adjust the size and visibility of the eyes of the person using it.


To be able to function properly as a computer screen at once contact lens real, this research takes years and the funds are not small. However, of course the progress of technology contact lens this can be expected in the future.


JR / TheTruthSeekerMedia

Washington DC Special Marriage Marriage for Gay Couples

deviate.jpg (268 × 300)


There is a different scene with this mass wedding event in the United States.If this marriage is usually done by a pair of humans, men and women.On Sunday (9/12/2012) it is not.
Light photos, bridal clothes, smiles and happy cries coloring the Seattle City Hall, United States.133 similar couples, both men and women participated as mass marriage participants.Hundreds of brides gathered in one room to bind holy promises.
After the appointment was spoken together, the participants left the room and were greeted by shouts and congratulations from friends, colleagues, and family.This is the first time a special gay couples mass wedding was held in Washington DC.
Previously, protests were raised by local residents to reject the legalization of gay couples to live together officially.But now, everything has changed.
"Today, Washington DC finally acknowledged our existence," said Robin Wyss, who has been dating his girlfriend, Danielle Yun for 8 years, as reported byCNN.
Spokesperson for Seattle Mayor Mike McGinn congratulated all participants."Here, you can see different types of couples from different generations, young and old, married together.It's a nice day, "he said.
After marriage, participants will receive a marriage certificate after undergoing several procedures, such as filling out data and interviews.The process and the way participants get written recognition can be accessed on the Seattle City website.
With this mass marriage, Bacon and the Wyss claimed to be relieved.Because, their status has been recognized by the government.
"Now the Wyss are not only friends, but also my husband.Before binding on the sacred vows at the ceremony, we only think of just gathering at City Hall, filling out documents and getting confessions.But, we do not think if there are a lot of applause that is welcome, "said Bacon.
The agreement of the Washington government with this type of marriage is very contrary to 38 other US states.The states still hold the law that marriage is only permissible between men and women.

IWD / TheTruthSeekerMedia

New US and Saudi Conspiracy in Yemen





Spokesman for the Yemeni Revolutionary Power, Ali Nasir al-Bakhiti confirmed the US and Saudi Arabian conspiracy against the al-Houthi militia through current Sanaa officials.


Al-Bakhiti Monday (10/12) when interviewed by al-Alam stressed that Yemeni President Abd-Rabbu Mansour Hadi on his tour of the United States called al-Houthi militia rebels, the new chairman of Yemen's national security at a Bahrain press conference also called al- Houthis rebels.


He added that a well-coordinated attitude among Yemeni officials showed a conspiracy to target al-Houthis based on the instructions of Saudi Arabia and the United States.


According to him, the statement is no different from the speech of former president Ali Abdullah Saleh while still leading Yemen. Thus the prediction is that the Saleh regime has not yet completely collapsed, but what has changed in Yemen is only the skin.


He considered the threat of Abd-Rabbu Mansour Hadi to overturn Ali Abdullah Saleh's legal immunity only aimed at domestic campaigns and showed his ability to control existing conditions.

"If Mansour Hadi really wants to cancel Saleh's legal immunity, he must dismiss the leader of the country's security and intelligence service who oversees the torture of the people for three decades," said al-Bakhiti.

He added, the purpose of this statement was to stall for time, attract sympathy for Yemeni public opinion and show that Mansour Hadi was a strong figure.


He also considered the friction between the authorities in this country as a result of the initiative of the Persian Gulf Cooperation Council (P-GCC) which not only did not resolve the crisis in Yemen, but instead postponed it.

"Friction between political camps has recently become more transparent," said al-Bakhiti.


IRIB / TheTruthSeekerMedia

Israeli Education Minister Critics Abu Mazen





The Israeli Minister of Education of the Zionist Regime, Gideon Sa'ar said, "I am very surprised that the officials of the Ramallah Authority were silent at the speech of the Hamas muqawama leader."


As Qodsna reported citing Euro News, after the end of Khaled Meshaal's visit, the head of the Hamas Political Bureau to the Gaza Strip and his anti-Israeli scathing statement delivered at the commemoration of the 25th Hamas, the Israeli Minister of Education said he was surprised why the Ramallah Authority officials were silent and shows no reaction.




Meshaal's first trip to Gaza caused various reactions among Israeli political parties. The Sa'ar statement is one of these reactions. "Previous Israeli officials made a fatal mistake when they allowed Hamas to take power in Gaza, because their attitude has made the Muqawama camp even stronger," Sa'ar said.


Gideon Sa'ar scathingly told Abu Mazen, "The important point is Meshaal transparently stated that he wanted to destroy Israel and Abu Mazen and other officials from the Ramallah Authority did not react to anything. They should have condemned Hamas's statement and rocket attacks on Israel. Abu Mazen instead tried to unite with Hamas which was supported by the Islamic Republic of Iran. "


IRIB / TheTruthSeekerMedia

This is Democrazy, Corruption is increasingly sophisticated, systemic and synergistic




Jakarta -: Cases of corruption have caused structural impoverishment, horizontal conflict, and ultimately led to a crisis in the role of the state. Until the era of President SBY, corruption in Indonesia was still rampant.

In an effort to commemorate World Anticorruption Day this week, let's examine: 1,408 corruption cases handled by law enforcement officers during 2004-2011 were evidence of the adverse effects of corruption. The value of state losses reached IDR 39.3 trillion. Such a budget can be used to build, for example, 393,000 simple houses or provide venture capital assistance for 3.9 million new graduates.
"When corruption reached Rp.33.3 trillion from 2004 to 2011 and it could be given such equivalent public facilities, we could no longer tolerate the slightest thing against corruption," said Deputy Chair of the Corruption Eradication Commission (KPK) Busyro Muqoddas,
The sad thing is also worrying, he continued, corruption regenerates.Regeneration can be seen from the number of corruption suspects with the age of under 40 years, the more there are.Women's involvement also increased.
The evolution of corruption, leads to new forms that are increasingly systemic and synergistic.The most dangerous model is designed corruption.The KPK found many regulations and policies, both in the central and regional governments, which were designed to legalize illegal things.
For example, drafting laws designed to legalize corruption.The law is an order. Another model is that a law that is actually good and oriented towards meeting people's needs is finally revised without logical reasons and without the basis of legal morality.There are also a number of laws that were submitted to the judicial review and finally declared unconstitutional.
Based on data from the Corruption Eradication Commission, from 332 suspects in corruption cases during 2004-2011, there were 106 of them, most of whom were echelon I-III officials..Next, 69 private suspects, 65 DPR and DPRD members, as well as regents / mayors and deputy regents / deputy mayors 31 suspects.
The corruption target varies, from the tax revenue sector, non-tax state revenues, goods and services expenditure, social assistance, regional levies, to regional transfers."However, corruption has caused structural impoverishment, horizontal conflict, and finally led to a crisis in the role of the state," Busyro said.
It is sad that when the integrity factor becomes a reference for the nations of the world to progress, in Indonesia it is just the opposite.Corruption even continues to regenerate massively. 1 total.408 corruption cases that robbed Rp39.3 trillion of public money during 2004-2011 were evidence of bad corruption.
Paramadina University Chancellor Anies Baswedan assessed that the world now cannot tolerate the presence of individuals without integrity.It's a shame that in this country, it is precisely corruption that supports the bureaucracy, the business world and the work of politicians, just look at the Hambalang case, Century, PLN inefficiency, fat accounts, tax mafia and so on.
So the KPK must work extra hard because corruption is systemic and endemic, while the prosecutor's office and the police are still full of corruption.Practically, the KPK is still a public hope. Until when?
IWD / TheTruthSeekerMedia

The Mystery of the Last Supper of Zaman




NOT DEFINED again that remembrance is the main capital in carrying out the main task of our lives, namely worshiping Allah. In fact, the whole core of worship is remembrance: calling, remembering, understanding, pondering, and practicing Allah's instructions. Remembrance is the lightest and cheapest worship. Remembrance is also a flexible worship, because it can be implemented in all places, times and circumstances. Therefore, it is lifelong worship.


We are used to listening to lectures or reading explanations that prayer and remembrance bring peace of mind, elevate degrees, increase merit, and abort sin. But what about the following 'extraordinary' things?


  • Tasbih, tahlil, tahmid, and takbir became physical food and drink when the Muslims experienced extreme droughts and famines for three years before the appearance of the Antichrist.
  • Tahlil and takbir which were echoed by 70,000 the Children of Ishaq the Al-Mahdi forces brought down the fortress of Constantinople on land, the sea, and the city gate.
  • Remembrance and prayer as Dzul-Qarnain's capital of power while building a barricade, as well as the capital of the nation Ya'juj and Ma'juj to puncture and undermine the barrier of the barrier, -and miraculously, as the weapon of Jesus and the Muslims to defeat and at the same time bury the people of Ya'juj and Ma'juj. In fact, all the inhabitants of the earth and the sky are not able to stem the brutality of the great, cruel and tough destructive nation!
  • Remembrance and prayer of personal saving from the massacre, strengthening the Islamic forces, imprisoning enemy troops, and delivering Muslim soldiers to martyrs; especially in times of end times and the struggle of Al-Mahdi-Prophet Isa to prosper the world with the divine law.
  • Recitation and prayer avoids the wealth and lives of the Muslims from natural disasters, at the end of the time earthquakes, meteor showers, intense darkness, and changes in human form often occur. In fact, prayer and remembrance can turn disaster into a blessing.
  • Recitation and prayer contain five powerful forces that save Muslims from all physical ailments, both preventive and curative.
  • Prayer and remembrance teaches the vision, mission, and operational steps that must be taken by the Muslims to maintain faith, improve charity, compile fusthath iman (faith group), and fortify it from treachery from within; while the Duhaima 's defamation which started the Dajjal, had come to slaughter Muslims.
  • Prayers and remembrance confront all the deceit, falsehood, and strength of the Antichrist. In fact, the Antichrist carries a river of water and fire, also a mountain of bread; able to command the heavens to bring down rain and the earth to grow plants; even reviving some people who have died.
  • Prayer and zeal bring honor to a Muslim to welcome the Prophet Jesus down from the sky, get a seal of faith from an able-bodied animal, and reach for repentance before the sun rises from the west.

IslamPos / TheTruthSeekerMedia


Wednesday, December 12, 2012

Test to Become More Noble





People say, life is like the wheel of life. Sometimes it is above, sometimes below. Some say life is like waves on the beach. Sometimes calm, but not infrequently also deliver waves that are so fast. Whatever human parables about this life, the point is that life will not be as calm as water in a pond. There will be shocks, obstacles, and tests of various forms.


Sometimes humans often feel unable to face life's trials. Even many who do not realize that all are delicious and all the tests come from only one source. All of that comes from the owner of all the souls of men and the rulers of all human hearts, namely God, the Almighty. Worse, there are also those who regret themselves, consider themselves to be too unlucky, so they never get happiness in life.


Maybe you've heard the story of a beautiful cup on display at a shop window. Before being there, it was just a piece of clay that no one really ignored. Then a craftsman took himself, formed the clay, then burned it in the fireplace. The clay was angry and resentful of the treatment he received. He must endure pain and heat. Do not get there, he must be willing to be painted in various colors, then burned again. All kinds of treatments are really unpleasant for him. But what happened, after all the process was complete, the clay found itself to have become a beautiful cup. He is no longer a smelly piece of clay, but he has become a new figure and certainly better. *


Maybe we as humans, often think like clay. The exams that come in every second of life are always responded to with impatience, complaining, and lack of sincerity. Not infrequently, maybe we feel too burdened with trust, feel that only ourselves are given a test, while others can have fun, and there are others who just stop and don't want to do it because they feel too tired, fatigued, and disappointed. . Not to mention the condition of the environment, family, and friends who are often ignorant, indifferent, and busy with their respective affairs.


But let's see the story of the beautiful glass. Look, how after all the processes have passed, a piece of clay has become a beautiful glass. How beautiful that change is. Right now you may be tested for various kinds of problems, ranging from problems in your family, parents, friends, workplaces, even the mandate of da'wah, but believe that God is forming you. It may be that you don't like that form, but you have to be patient. Isn't there always convenience after trouble? Remember, clouds are not always cloudy, once in a while it will be bright cloudy shade the sky. Even hurricanes do not always blow the wind fast, in time they will calm down and subside again.


Once, a friend once said, if you feel yourself getting a test that is so heavy, be kind to yourself and to God. Remember that God is always according to his servants' presuppositions. Let's just say when tested with various problems, you are on a test period like a schoolboy. To be able to go up the level, there must be an exam to test readiness. The higher the level, the higher the level of complexity of the exam given. Believe me, if you succeed in facing this test, you will succeed in rising to the level of Allah, becoming a true believer. Allah will not give a test according to the ability of His servant. If God is sure we can, our own time is not sure of our abilities?


For my brothers and sisters who are currently being tested by God, whatever the form of the test is, cheer up and be patient. Rejoicing because of the exam means that God still cares and cares for us, so he gives a test so that we are stronger, wiser and more noble. God wants us to be better in His presence. After that, be patient because truly patience will produce peace of mind, strength of heart, and truly God is always with people who are patient. Be patient, because Allah will not leave His servant who has faith, it is precisely man who often leaves the creator.


What do people who have lost God come from within them? And what should those who find God have to look for in them? Indeed between the first and second will never be the same. The second person will get everything, and the first person will lose everything.


***


Wallahualam


* stories are adapted from the book "Strength of Love"
** adapted from the book "La Tahzan!"


EM / TheTrutSeekerMedia

American Marines Returning to Nature



My name is Jacian Fares. I am a descendant of the Al Fares family from Hebron. My father was born in Lebanon, while my mother was a Spanish woman. I was the first generation of my family born in the United States, precisely in the city of Dearbon, the state of Michigan.

My father didn't really care about religion, even though my grandfather was a devout Muslim. So it is not surprising if my brother and I grew up without knowing a particular religion. We were raised as American children, period.

I can imagine, how my father's indifference and the way of life he chose had saddened my grandparents.

Believe in not believing, among the three of us only I have lived in Lebanon for 6 years, that is when I was a teenager. The experience of living in Lebanon is arguably my first contact with Middle Eastern culture.


My second touch with Middle Eastern civilization occurred when I served as a member of the United States Navy, as a Marine. I was leading the US forces invading Iraq, a war that I did not agree with, but what I could say because I was just a soldier.


In Fallujah and other places in Al Anbar Province, I tried to get to know the locals. I pay attention to the habits of the Arabs during the month of Ramadan from year to year. I watched how they were so obedient and obedient to their religion.


Malang cannot be avoided. One time I was shot in Iraq and lost one of my two kidneys. I believe that is God's will, because I'm sure every incident must have a reason behind it.


When I returned home to the United States, I was very depressed, depressed and feeling empty, not knowing what to do in this life. I'm used to having a certain routine as a soldier, and now it's all gone. My social relations at that time were at a nadir. I am lonely.


In the midst of anxiety, my grandparents and aunts showed me the way to Islam. During 2008 my work was only reading the Koran. And that feels like straight away
'continue'.

In my opinion the Qur'an is very reasonable, far more reasonable than the Bible and Torah. The Qur'an is very straightforward, not long-winded. The life of a Muslim has a routine. And that's what I need to change my life, to find a true identity.


Finally, I have a routine. I have a reason to live in this world, to make my life better.


You could say I later got a lot of friends, from all over the Middle East, like from Egypt, Palestine, Jordan and Qatar. And my friends helped me become what I am today. For that favor, I'm very grateful.


Even though I'm stranded in America alone, I'm not lonely. People in the Muslim community always treat me as a member of their family.

In the second Ramadhan (2009) I was unable to fast, due to diabetes. Instead, I give alms for food, money and also time to help people who need for 30 full days. The end of the second Ramadhan is very special, because the 1st of Shawwal coincides with my birthday.

I like Ramadan and the wisdom behind it. Ramadan reminds us to always be good Muslims. I invite all Muslims to make their lives every day like in the month of Ramadan.


We as Muslims, can make this world a better place to live, no matter how badly the media views and describes us.

Muslims need not force others to believe in Allah. We can explain to people who do not understand Islam in a good way. That's what I experienced, where I got help and help from relatives, friends and family in Islam.

I call on those who have not believed in al-Qur'an, open your eyes wide and read al-Qur`an with an open view. Al-Qur`an is a tool, with which we lead a life through the right path. Islam teaches peace, love and a strong faith in God. *


Hidayatullah / TheTruthSeekerMedia

Waiting for Collapse ‘Pillar of Defense '



Dina Y. Sulaeman *

Only nine days have passed since the failure of the 'Pillar of Defense' military operation, Israel must accept another bitter pill, be humiliated in the diplomatic field. Just imagine, of the many Western countries that have been allies, only three countries expressly reject the granting of 'state' status to Palestine, namely the US, Canada and the Czech Republic. Apart from these three countries, Israeli supporters are only Panama and four countries in the Pacific whose names are rarely heard: Marshall Islands, Micronesia, Nauru and Palau.


In the world of diplomacy, words become very sensitive and must be considered carefully, especially when it comes to countries that have been very privileged, Israel. Usually, in UN sessions, the debate to choose the words 'condemn', 'condemn', or 'regret' can take a long time. But now, 138 countries, including France, Russia and China, agree to support Palestine. Even the attitude of abstaining from England and Germany had already slapped the face of Israel.

Israel is now truly pariah at the United Nations. The illusion he built through military operations which in Hebrew is called Amud Anan (can be translated 'pillars of defense' or 'pillars of clouds') failed miserably. It is said that 3000 years ago, when the Jews fled from the pursuit of the Pharaoh's army, the pillars of clouds appeared to protect them. Israel wants to create the illusion that its blind bombing in Gaza was an attempt to protect Jews from the brutality of its enemies, represented by Palestinian fighters. Israel's propaganda machines have been trying to portray that Palestine is committing violence while Israel is only defending itself.


But now, the situation has changed. Progress in information technology has made the world unable to claim to not know what really happened in Palestine. Israeli brutality appeared live on television and uploaded on you tube. Photographs of bloodied Palestinian children are widespread in just seconds through Facebook and blogs. The world has run out of reasons to defend Israel. Now Israel is no longer a 'small Muslim country surrounded by barbarian Arabs who always want to kill Jews'; a propaganda that has often been echoed. The image of Israel is now a small country that is stubborn and annoying because its brutal actions have embarrassed Western countries that have supported it.


And now the Palestinians are rejoicing, even though the Israeli bomb attacks and military violence still continue sporadically. The armed struggle of Hamas and Islamic Jihad succeeded in making Israel frightened. Israel was only able to bombard Gaza for 8 days and immediately requested a ceasefire because it could not bear to receive a counterattack in the form of rockets that had even been able to reach Tel Aviv. The victory of Palestinian fighters is now also coupled with a diplomatic victory with the passage of Palestine as a 'non-member observer country'.

That is, now the United Nations officially gives 'state' status to Palestine. Previously, since the PLO declared Palestinian independence in Algiers in 1988, the United Nations always called Palestine an 'entity'. Even though there have been more than 100 UN member states that recognize Palestine as a country and establish bilateral diplomatic relations with it. Furthermore, if using the UN standard, Palestine has long since fulfilled all the conditions set by the United Nations to be recognized as a state, among others, having a population and government, being peaceful and willing to accept the UN Charter.


The Palestinian 'love of peace' attitude was demonstrated by Yaser Arafat, the first Palestinian President, through his acceptance of UN Resolution number 181. The resolution released in 1947 awarded 56.5% of the Palestinian territory for the establishment of a Jewish state, the remaining 43% for Palestinian states, while Jerusalem was made into an international territory. The acceptance of this resolution is already beyond common sense: how could a nation want to divide its land with immigrant nations that were deliberately brought in from various parts of the world and unilaterally claim the right to that land? But Arafat still stated his acceptance.


In 1994, Arafat went further to prove his willingness to negotiate with Israel. In the Oslo Agreement, Arafat said he was willing to recognize Israel's sovereignty and promised to safeguard the security of the Israeli people. In return, Israel recognizes the authority of the Palestinian Authority in the Gaza and Jericho regions, which is only 2% of the entire Palestinian territories stipulated by Resolution 181. In this agreement, the Palestinian Authority has become an extension of Israel in suppressing Palestinian militant groups (Hamas, Jihad) Islam, etc.) in the agreement referred to as 'terrorists'.


Furthermore, various agreements and peace efforts between Palestine and Israel have been pursued, but their implementation has always hit a thick wall, namely the nature of the Zionist regime itself which has always prioritized violence and regional expansion ambitions. The regime continues to build settlements in the West Bank, even though its close US allies have repeatedly banned. In addition to the routine violence carried out by the Israeli army against Palestinians and the blockade of Gaza, massive military operations were launched by Israel.
This proves that even though Palestinians have tried to be good with Israel through negotiations, their rights remain ignored by Israel.


These are important points that need to be remembered by Palestinians and Palestinian supporting countries. Right, this is a sweet moment, but it doesn't take too long to rejoice. The struggle to defend Palestine is still long. Israel has prepared to avenge its diplomatic defeat by building more Jewish settlements in the West Bank and holding back the Palestinian Authority tax money.

Israeli propaganda machines also began to try to divert public opinion which initially hailed the success of the Hamas struggle and Islamic Jihad to the importance of diplomatic efforts. The premise that violence will not succeed in achieving peace is reverberated, without remembering who actually started violence and who committed more violence.


As said Miko Peled, a former Zionist who has now turned to criticizing Zionism, Israel will not voluntarily stop doing its crimes; as in the past apartheid regime in South Africa or white US people who did not voluntarily recognize the equal rights of black people. Racist regimes must be forced to collapse and be replaced by a democratic, peace-loving regime, and recognize equal rights between various religions and races. And to achieve this, the international world must continue to put pressure on Israel, not limited to providing observer status to the Palestinians. The pressure must be made until the Zionist regime's 'pillar of defense' really collapses.


*Guest researcher at the Global Future Institute, author of Ahmadinejad on Palestine
[This article has been published in Sindo Weekly Magazine no 40, 6-12 Dec 2012 with the title 'Congratulations to Dinda Palestina']